Skip to main content

Table 1 Primers sequences (nucleotide sequences) used during quantitative RT-PCR

From: FGF gene expression in injured tendons as a prognostic biomarker of 1-year patient outcome after Achilles tendon repair

Genes Forward Primer Reverse primer
FGF TGACGGGGTCCGGGAGAAGA ATAGCCAGGTAACGGTTAGCACACAC
COL III CACGGAAACACTGGTGGACAGATT ATGCCAGCTGCACATCAAGGAC
FN TTTGCTCCTGCACATGCTTT TAGTGCCTTCGGGACTGGGTTC
COL I GGCAACAGCCGCTTCACCTAC GCGGGAGGACTTGGTGGTTTT
MMP-9 AGCGAGGTGGACCGGATGTT AGAAGCGGTCCTGGCAGAAATAG
GAPDH CCTCCTGCACCACCAACTGCTT GAGGGGCCATCCACAGTCTTCT