Skip to main content

Table 1 Primers Selected for PCR Analysis (from PrimerBank)

From: Prolotherapy agent P2G is associated with upregulation of fibroblast growth factor-2 genetic expression in vitro

Gene Relevance to cartilage Primer Sequence
FGF-2 Growth factor regulating chondrogenesis and proliferation [12]. Forward: TTAAACGAGTCTTCAAGGTGGTG
CCND-1 Directly promotes the G1/S transition of the cell cycle [66] Forward: GCGTACCCTGACACCAATCTC
IGF-1 Growth factor regulating proliferation, bone mineralization, and cartilage ECM production [30, 35, 41] Forward: AGAGGCTACCCGCCTAGTTC
TGF-β1 Growth factor regulating proliferation and bone formation [35, 59] Forward: CTGGACTCATCGCAAACACAA
BMP-2 Osteoblast differentiation and mineralization [35, 57] Forward: GGGACCCGCTGTCTTCTAGT
STAT-1 Transcription factor likely involved in mediating FGFR3 [44] Forward: TCACAGTGGTTCGAGCTTCAG
RPL13A Housekeeping control gene [53] Forward: CCCTCCACCCTATGACAAGA