Skip to main content

Advertisement

Table 1 Sequences of the primers used in this study

From: The cytokine expression in synovial membrane and the relationship with pain and pathological findings at hip arthroscopy

Gene Direction Primer Sequence (5’–3’) Product Size (bp)
TNFα F CTTCTGCCTGCTGCACTTTG 118
R GTCACTCGGGGTTCGAGAAG  
IL1β F GTACCTGTCCTGCGTGTTGA 153
R GGGAACTGGGCAGACTCAAA  
IL6 F GAGGAGACTTGCCTGGTGAAA 199
R TGGCATTTGTGGTTGGGTCA  
ADAMTS4 F ACGTGCTCCATGACAACTCC 159
R TGCCCATAGCCATTGTCCAG  
MMP1 F ACTTACATCGTGTTGCGGCT 164
R CGATGGGCTGGACAGGATTT  
MMP3 F GTGGAGTTCCTGACGTTGGT 164
R TGGAGTCACCTCTTCCCAGA  
GAPDH F TGTTGCCATCAATGACCCCTT 202
R CTCCACGACGTACTCAGCG