Skip to main content

Table 1 Primers used for real-time RT-PCR

From: Effects of rAAV-mediated FGF-2 gene transfer and overexpression upon the chondrogenic differentiation processes in human bone marrow aspirates

Gene Primer sequences (5’-3’)
ACANa GAGATGGAGGGTGAGGTC
ACGCTGCCTCGGGCTTC
COL2A1a GGACTTTTCTCCCCTCTCT
GACCCGAAGGTCTTACAGGA
SOX9a ACACACAGCTCACTCGACCTTG
GGGAATTCTGGTTGGTCCTCT
COL1A1b ACGTCCTGGTGAAGTTGGTC
ACCAGGGAAGCCTCTCTCTC
COL10A1c CCCTCTTGTTAGTGCCAACC
AGATTCCAGTCCTTGGGTCA
MMP13c AATTTTCACTTTTGGCAATGA
CAAATAATTTATGAAAAAGGGATGC
ALPb TGGAGCTTCAGAAGCTCAACACCA
ATCTCGTTGTCTGAGTACCAGTCC
RUNX2b GCAGTTCCCAAGCATTTCAT
CACTCTGGCTTTGGGAAGAG
GAPDHd GAAGGTGAAGGTCGGAGTC
GAAGATGGTGATGGGATTTC
  1. SOX9 SRY (sex determining region Y)-box 9, COL2A1 type-II collagen α1, ACAN aggrecan, COL1A1 type-I collagen α1, COL10A1 type-X collagen α1, MMP13 matrix metallo-proteinase 13, ALP alkaline phosphatase, RUNX2 runt-related transcription factor 2, GAPDH glyceraldehyde-3-phosphate dehydrogenase. aChondrogenic markers; bOsteogenic markers; cHypertrophic and terminal differentiation markers; dHousekeeping gene (control)